Brian Odonovan

AGCGCGGTGATTAACGGCCTGATTGTGGAAAGC

Role
Sr Director of Bioinformatics & Computational Biology at Delve Bio
Location
Spokane, WA, US
LinkedIn followers
500 followers

Experience

  1. Sr Director of Bioinformatics & Computational Biology

    Delve Bio

    Apr 2023 — Present

Education

  • University of California, San Francisco

    Doctor of Philosophy (Ph.D.), Biological and Medical Informatics - Complex Biological Systems

    2012 — 2017

  • UC San Diego

    B.S. Bioengineering, Biotechnology

    2004 — 2008

  • University of California, San Francisco

    Master’s Degree, Biological and Medical Informatics

    2012 — 2015

Skills

  • Biotechnology
  • Biomedical Engineering
  • Biomaterials
  • Molecular Biology
  • Lifesciences
  • Biochemistry
  • Computational Biology
  • Medical Devices
  • Cell Culture
  • Data Analysis
  • Fluorescence Microscopy
  • Bioinformatics
  • Bioengineering
  • Mammalian Cell Culture
  • Microfluidics
  • Fda
  • Iso 13485
  • Quality System
  • Design Control
  • Product Development
  • Cross-Functional Team Leadership
  • Metagenomics
  • Clinical Metagenomics
  • Phage Display
  • Genome Analysis

Find verified contacts for anyone on LinkedIn

Unifers gives sales teams verified emails and direct dials, enriched profiles, and outreach that lands in the inbox.

Free plan included · No credit card required

This profile is compiled from publicly available professional sources. Unifers is not affiliated with or endorsed by LinkedIn. Request removal of this profile.

Brian Odonovan — Sr Director of Bioinformatics & Computational Biology at Delve Bio in Spokane, WA, US | Unifers