Brian Odonovan
AGCGCGGTGATTAACGGCCTGATTGTGGAAAGC
- Role
- Sr Director of Bioinformatics & Computational Biology at Delve Bio
- Location
- Spokane, WA, US
- LinkedIn followers
- 500 followers
Experience
Sr Director of Bioinformatics & Computational Biology
Apr 2023 — Present
Education
University of California, San Francisco
Doctor of Philosophy (Ph.D.), Biological and Medical Informatics - Complex Biological Systems
2012 — 2017
UC San Diego
B.S. Bioengineering, Biotechnology
2004 — 2008
University of California, San Francisco
Master’s Degree, Biological and Medical Informatics
2012 — 2015
Skills
- Biotechnology
- Biomedical Engineering
- Biomaterials
- Molecular Biology
- Lifesciences
- Biochemistry
- Computational Biology
- Medical Devices
- Cell Culture
- Data Analysis
- Fluorescence Microscopy
- Bioinformatics
- Bioengineering
- Mammalian Cell Culture
- Microfluidics
- Fda
- Iso 13485
- Quality System
- Design Control
- Product Development
- Cross-Functional Team Leadership
- Metagenomics
- Clinical Metagenomics
- Phage Display
- Genome Analysis
Find verified contacts for anyone on LinkedIn
Unifers gives sales teams verified emails and direct dials, enriched profiles, and outreach that lands in the inbox.
Free plan included · No credit card required
This profile is compiled from publicly available professional sources. Unifers is not affiliated with or endorsed by LinkedIn. Request removal of this profile.